Morphological and molecular characterization of Encotyllabe vallei Monticelli, 1907 (Monopisthocotylea, Monogenea) from the gilthead seabream Sparus aurata Linnaeus (Teleostei, Sparidae) from the southwestern Mediterranean and notes on host specificity of the genus Encotyllabe Diesing, 1850

Abstract

Incomplete original descriptions, the unavailability or poor conditions of specimens and the lack of detailed redescriptions have caused the validity of several species of the genus Encotyllabe Diesing, 1850 to be questioned. To date, seven of the recognized species were described upon one or two specimens, hindering study of intraspecific variations. This was made worse by considering few morphoanatomical differences sufficient to erect new species. Among Encotyllabe spp. occurring in Mediterranean waters, E. vallei was first described from the gilt-head bream Sparus aurata (Sparidae) off Italy. Although beautifully illustrated for a paper from that century, morphometric data for E. vallei from the type-host S. aurata remain unavailable. Previous records of E. vallei provided either morphometrical or molecular data, and its validity was questioned. We provide a redescription of E. vallei based on newly collected specimens from the S. aurata from the southwestern Mediterranean (off Algeria) using integrative taxonomy. Analysis of cox1 sequences of E. vallei from S. aurata, compared to sequences from other sparid hosts, mainly Pagellus bogaraveo, revealed a divergence not exceeding 2%, suggesting a stenoxenic specificity for this monogenean. Given that P. bogaraveo is the type-host for Encotyllabe pagelli, we were tempted to suggest a synonymy between E. vallei and E. pagelli. We refrained from doing so because E. pagelli was first described from the Atlantic coast off Brest, France. Morphological data for Encotyllabe from P. bogaraveo are warranted assessing the host specificity of E. vallei and whether there might be a species complex within individual sparid fish species.

Introduction

Capsalid monogeneans belonging to the genus Encotyllabe Diesing, 1850 are ectoparasitic Monopisthocotylea. They are commonly found on various parts of marine fish, such as the gills, body surface, mouth and pharyngeal toothpads of marine fish. Species of this genus are recognized by the elliptical ventral suckers surrounded by a wide membrane and a pedunculated aseptate haptor equipped with two pairs of substantial hooks and several marginal hooklets (Price 1939).

Encotyllabe spp. are known to inhabit a wide range of waters, encompassing temperate, subtropical and tropical regions (Lebedev 1967). They have a broad host spectrum (Table 1), infecting various teleost fish families (Sepúlveda et al. 2014). Currently, there are 24 species attributed to this genus (WoRMS 2023), however, the validity of several of these species has been questioned due to the incomplete and brief original descriptions (Taborda et al. 2023), the unavailability or poor conditions of some type specimens (Sepúlveda et al. 2014) and the lack of detailed redescriptions. Additionally, seven of the total recognized species were initially described based on only one or two specimens, which hinders the ability to understand intraspecific variability (Sepúlveda et al. 2014). Occasionally, minor morphoanatomical differences have been deemed sufficient grounds for the creation of new species (Khalil and Abdul-Salam 1988; Martorell 2004).

Table 1. The distribution of Encotyllabe spp. according to the systematics of host groups, reproduced from Lebedev (1967), updated. Note that E. latridis mentioned by Lebedev (1967) was omitted because it is currently included in Mediavagina Lawler and Hargis, 1968. Encotyllabe masu Ishii and Sawada, 1938; E. monticelli Perez Vigueras, 1940; E. pricei Koratha, 1955 and E. punctatai Gupta et Krishna, 1980 as species inquirendae because these species were poorly described, based on only one or two specimens.

1 was originally described in an unpublished thesis and never published according to the rules of the International Code for Zoological Nomenclature; it is not considered valid (see Taborda et al. (2023)).

2 Yamaguti (1934) noted that both E. pagelli and E. pagrosomi are parasitic in the sparid Pagrus auratus and probably more closely related to E. spari, but because the original papers of these species were inaccessible to him, he noted that his species should be looked upon as a provisional one.

Only three Encotyllabe species occur in the Mediterranean: Encotyllabe paronae Monticelli, 1907, described from the East Atlantic peacock wrasse Symphodus tinca Linnaeus, 1758 (Labridae); Encotyllabe nordmanni Diesing, 1850, described from two Bramidae, the Mediterranean pomfret Brama mediterranea (Bonnaterre, 1788) and the Atlantic pomfret Brama brama (Bonnaterre 1788) and a Pomacentridae Chromis (Linnaeus 1758). Two species are known from sparid fishes: Encotyllabe pagelli Van Beneden and Hesse, 1863, from the blackspot seabream Pagellus centrodontus (Delaroche 1809) collected off Brest, France, and E. vallei Monticelli, 1907, described from the gilt-head bream Sparus aurata Linnaeus, 1758 (Sparidae Rafinesque 1818) off Trieste, Italy. Encotyllabe vallei had been rarely mentioned, and apart from Radujkovic and Euzet (1989), the previous accounts provided scant or no morphometric data and lacked illustrations. Consequently, the brief original description has made it difficult to discern differences from other species (Taborda et al. 2023). As a result, assessing its similarities to and differences from other Encotyllabe species remains challenging due to the absence of morphometric data which led to its recent classification as species inquirendae (Taborda et al. 2023).

In this study, we provide an illustrated redescription of E. vallei based on newly collected specimens from the type-host S. aurata collected from the western Mediterranean, Algeria. We also provide cox1 and 28S sequences and discuss the host specificity of E. vallei.

Material and methods

During the years 2020–2021, 115 specimens of S. aurata were collected from off Dellys (36°54′ 48″N, 3°54′ 51″E), Zemmouri El Bahri (36°48′ 4.58″N, 3°34′ 7.01″E), Cap Djinet (36°52′ 37″ N, 3°43′ 23″E), Bouharoun (36′370 24″ N, 2°39′ 17″ E) and Cherchell (36°36′ 31″ N, 2°11′ 50″ E) off the Algerian coast. Fish specimens were purchased dead from fishermen, transferred to the laboratory shortly after capture, identified using keys (Fischer et al. 1987; Kullander and Delling 2012) and examined fresh on the day of purchase.

Gills and pharyngeal tooth pads were detached, placed in individual Petri dishes containing saline solution following Lablack et al. (2022) and carefully examined for monogeneans under a stereomicroscope (Carl Zeiss Microimaging GmbH 37081 Göttingen, Germany). Monogeneans were removed from gills using fine dissection needles, heat-killed and preserved in molecular biology-grade ethanol and 70% ethanol for molecular and morphological analyses, respectively. We followed the terminology as defined by Combes (2003) to describe the host specificity of a parasite in relation to the relatedness of host species: Oioxenic is employed for parasites that exploit a single host species; the parasite is denoted as stenoxenic if it exploits a range of phylogenetically related species and euryxenic if it exploits a range of mutually unrelated species.

Morphological methods

For morphological study, monogeneans were stained with acetic carmine, dehydrated in graded ethanol series (70%, 95% and 100%), cleared in clove oil and mounted in Canada balsam using a Wild Heerbrugg stereo microscope. Voucher material was deposited at the Swedish Natural History Museum, Stockholm, Sweden, under registration numbers SMNH-208363–208373, SMNH-218760–218780. Drawings were made with the help of a Nikon Eclipse 80i microscope equipped with differential interference contrast (DIC) and a drawing tube (Department of Zoology, Swedish Museum of Natural History). Drawings were scanned and redrawn on a computer with Adobe Illustrator 2023. Measurements are in micrometers and indicated as the range followed by the mean.

Molecular methods

Three monogeneans were selected for DNA extraction. For three S. aurata, one monogenean was extracted. A tissue sample from the gill of the fish was taken, preserved in absolute ethanol and deposited as a voucher in the SMNH. For the monogenean, a small lateral part of the body above the haptor was separated with a scalpel following previous works on the barcoding of Monogenea (Ayadi et al. 2022; Azizi et al. 2021; Bouguerche et al. 2019a, 2019b; Bouguerche et al. 2019; Bouguerche et al. 2020; Bouguerche et al. 2021; Lablack et al. 2022) and submitted to molecular analysis, and the rest of the body was mounted on a slide as a voucher for drawing and deposition in a museum collection (Figure 1A). This enables the morphological assessment of sequenced monogeneans. Slides of monogeneans used for molecular work were deposited in the SMNH under registration numbers SMNH-208 363, SMNH-208 364 and SMNH-208 365.

Figure 1. Encotyllabe vallei (Monticelli, 1907) ex S. aurata. A, Hologenophores SMNH-208 365 (GenBank OR148273); B, voucher, whole body, SMNH-208 366; C, Large hamulus; D, small hamulus.

Molecular barcoding of Monogenea

For cox1, total genomic DNA was isolated using a QIAmp DNA Micro Kit (Qiagen). The specific primers JB3 (=COIASmit1) (forward 50–TTTTTTGGGCATCCTGAGGTTTAT–30) and JB4.5 (=COI-ASmit2) (reverse 50–TAAAGAAAGAACATAATGAAAATG–30) were used to amplify a fragment of 402 bp of the cox1 gene (Bowles et al. 1995; Littlewood et al. 1997). PCR reactions were performed in 20 μl of a mixture containing 1 ng of DNA, 1 CoralLoad PCR buffer, 3 mM MgCl2, 0.25 mM dNTP, 0.15 μM of each primer and 0.5 units of Taq DNA polymerase (Qiagen). Thermocycles consisted of an initial denaturation step at 94°C for 2 min, followed by 37 cycles of denaturation at 94°C for 30 s, annealing at 48°C for 40 s and extension at 72°C for 50 s. The final extension was conducted at 72°C for 5 min. PCR products were purified (Ampure XP Kit, Beckman Coulter) and sequenced in both directions on a 3730 l DNA Analyzer 96-capillary sequencer (Applied Biosystems, Foster City, CA, USA). We used CodonCode Aligner version 3.7.1 software (Codon Code Corporation, Dedham, MA, USA) to edit sequences and compare them to the GenBank database content with BLAST and deposited them in GenBank under accession numbers OR148271, OR148272, OR148273.

For 28S, DNA was extracted using a QiaAmp DNA Micro Kit (Qiagen). A 28S rDNA fragment of 884 bp was amplified using the universal primers C10 (50–ACCCGCTGAATTTAAGCAT–30) and D2 (30–TCCGTGTTTCAAGACGG–50) (Hassouna et al. 1984). PCR reactions were performed in a final volume of 20 mL, containing: 1 ng of DNA, 16 CoralLoad PCR buffer, 3 mM MgCl2, 66 mM of each dNTP, 0.15 mM of each primer and 0.5 units of Taq DNA polymerase (Qiagen). Thermocycles consisted of an initial denaturation step at 94°C for 1 min, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s and extension at 72°C for 1 min. The final extension was conducted at 72°C for 7 min. PCR products were visualized on a 1.5% agarose gel, purified and directly sequenced in both directions on a 3730xl DNA Analyzer 96-capillary sequencer (Applied Biosystems) at Eurofins Genomics. Sequences were edited and assembled using CodonCode Aligner software (CodonCode Corporation, Dedham, MA, USA) and compared to the GenBank database content with BLAST. Sequences from three individual monogeneans were obtained and were found to be identical; they were deposited in GenBank under accession numbers OR149163, OR187608.

Molecular analysis

Trees were constructed using our newly generated sequences and those of closely related taxa available in GenBank. For 28S, we used almost all closely related sequences available in GenBank (Table 2), except for those that were too short and/or did not align well. A sequence of a monocotylid Holocephalocotyle monstrosae Derouiche, Neifar, Gey, Justine and Tazerouti, 2019 (Derouiche et al. 2019) was used as an outgroup. The 28S dataset included 50 nucleotide sequences. Both extremities of the sequences were trimmed to obtain a clean matrix. After estimating the best model with MEGA7 (Kumar et al. 2016), the tree was inferred using the maximum likelihood (ML) method based on the general time reversible model (GTR) with gamma distributed with invariant sites (G+I).

Table 2. Sequences used in the molecular analysis of 28S sequences of monogeneans.

*, new sequences.

For cox1, the newly generated sequences of E. vallei were aligned with 25 species of Encotyllabe recovered after BLAST (Table 3). Two sequences of Empruthotrema aoneken Irigoitia, Braicovich, Rossin and Timi in Irigoitia, Braicovich, Rossin, Canel, Levy, Farber and Timi, 2019 (MN190708, MN190709 (Irigoitia et al. 2019)) were used as an outgroup. The trimmed matrix included 261 positions in the dataset. The tree was inferred using the ML method based on the Hasegawa–Kishino–Yano model (HKY) with gamma distributed (G).

Table 3. Sequences used in the molecular analysis of cox1 sequences of monogeneans.

*, new sequences. numbers SNHM 208 363-208 373, SMNH 218 760-218 780.

All trees were constructed in MEGA7, with 500 replications for the ML trees. The neighbour-joining (NJ) method was also used for comparison in MEGA7, with 2000 bootstraps computed for cox1 and 28S from the same datasets. Distances (p-distances and Kimura two parameter) were computed from the same datasets with MEGA7(Kumar et al. 2016).

Results

Molecular characterization of monogeneans

For the 28S gene, molecular data were generated for three specimens of E. vallei collected from S. aurata off Algeria, Western Mediterranean (OR148271, OR148272, OR148273). The alignment of the new 28S sequence data with that of related taxa, primarily Encotyllabinae Monticelli, 1892, Benedeniinae Johnston and Capsalinae Baird, 1853, yielded 1288 characters. The final dataset used for phylogenetic analysis included 846 characters. The phylogenetic analysis using both ML and NJ methods produced phylograms with identical topologies (Figure 2). In these phylograms, each of the four capsalid subfamilies represented a distinct and well-supported clade. Within Encotyllabe, three subclades were identified: the first included Encotyllabe sp1. collected from P. bogaraveo, while the second included E. vallei from S. aurata and D. vulgaris. The third subclade within Encotyllabe included the following species: Encotyllabe sp. from Pagrus pagrus, Encotyllabe sp. from Orthopristis ruber, E. caballeroi, Encotyllabe cheilodactyli, Encotyllabe chironemi, E. cf. spari and Encotyllabe antofagastensis.

Figure 2. Maximum likelihood tree based on an analysis of 28S sequence data for Capsalidae. Bootstrap percentages (500 replicates) are indicated next to or below the branches (only values >70% are shown). There was a total of 846 positions in the final dataset. The NJ tree (p-distance method) had a similar topology and is not presented.

There were no intraspecific variations within our newly generated sequences of E. vallei. Additionally, all sequences of E. vallei from the Western Mediterranean (off Algeria) were identical, irrespective of host. Overall, the genetic distance between the newly generated sequences and those of Capsalidae ranged from 1% to 33%, while the divergence among Encotyllabe spp. ranged from 1% to 2%. The closest sequences to our newly generated sequences of E. vallei were those of E. chironemi from Chironemus marmoratus off Australia, Encotyllabe cf. spari from O. ruber off Brazil, Encotyllabe sp. from P. pagrus, and from O. ruber off Brazil, and E. antofagastensis from Anisotremus scapularis off Chile (1% interspecific variation).

The newly generated cox1 sequences (OR148271, OR148273 and OR148273, respectively) were 433, 416 and 432 bp long. Deleted ambiguously aligned characters resulted in a final dataset of 261 characters for phylogenetic analysis. The ML and NJ analyses also have identical topologies and only the ML tree is shown (Figure 3). In the cox1 dataset, the same clades (when cox1 and 28S sequences are both available for a given species) were represented with much greater levels of difference between them. All sequences of E. vallei from Algeria clustered in a well-supported clade. Similarly, Encotyllabe sp. and Encotyllabe sp. 2 from O. ruber and A. scapularis, respectively, formed well-supported monophyla.

Figure 3. Maximum likelihood tree based on an analysis of cox1 sequence data for Encotyllabe spp. Bootstrap percentages (500 replicates) are indicated next to or below the branches (only values > 70% are shown). There was a total of 261 positions in the final dataset. The NJ tree (p-distance method) had a similar topology and was not shown.

The replicate cox1 sequences of E. vallei generated in the present study differed between them by 0% to 1% (intraspecific variations). All genotypes of E. vallei from Algeria from different hosts differed by 1% to 2% divergence in P-distances.

Morphology of E. vallei Monticelli, 1907 (Figures 1 and 4 )

Type-host: S. aurata (Linnaeus), the gilt-head (sea) bream (Sparidae).

Additional hosts: Dentex sp., D. dentex (Linnaeus.), Diplodus puntazzo (Walbaum) and Mullus surmuletus Linnaeus.

Type-locality: Trieste, Italy (Monticelli, 1907).

Figure 4. Encotyllabe vallei (Monticelli, 1907) ex S. aurata, Detail of the reproductive organs in the region of the vagina (SMNH-208 367).

Additional localities: Montenegro, Spain. Off Bouharoun, off Dellys (36°54′ 48″N, 3°54′ 51″E), Zemmouri El Bahri (36°48′ 4.58″N, 3°34′ 7.01″E), Cap Djinet (36°52′ 37″ N, 3°43′ 23″E), Bouharoun (36′370 24″ N, 2°39′ 17″ E) and Cherchell (36°36′ 31″ N, 2°11′ 50″ E), Algeria (this paper).

Site on host: pharyngeal tooth pads, gills.

Prevalence and intensity: ex S. aurata off Algeria: 34% (31 out of 90 fish).

Specimens from Algeria, from S. aurata (Figures 1 and 4): vouchers deposited in the collections of the Swedish Museum of Natural History, Stockholm (SMNH-208363–SMNH-208373; SMNH-218760–SMNH-218780).

Specimens with molecular information: entire specimen lacking only a small lateral part (below the haptor) parts of specimens mounted on slide, lateral excised part used for molecular analysis: specimens from Algeria, from S. aurata: SMNH-208 363 (GenBank accession numbers OR149163, OR148271), SMNH-208 364 (GenBank accession numbers OR187608, OR148272), SMNH-208 365 (GenBank accession numbers OR148273).

Redescription

Measurements and description based on 33 stained and mounted specimens (Table 4). Body stocky, 1727 ± 267 (1106– 2280, n = 32) long, 693 ± 143 (447–1072, n = 32) maximum width at posterior third of body proper (Figure 4B). Two prohaptoral suckers muscular, 138 ± 33 (82–192) in diameter, oval, embedded in a lobed pad located in anterolateral margin of anterior region. Pharynx pyriform muscular. Two pairs of eyespots visible at level of pharynx. Intestinal ceca branched, with few lateral diverticula, mostly obscured by vitellarium, confluent posteriorly.

Table 4. Measurements of E. vallei from different hosts and localities.

* Diameter.

Haptor bell-shaped, without septa; peduncle 464 ± 100 (227–666, n = 32) in length. Haptor armed with a pair of large hamuli (Figure 4C), a pair of smaller hamuli (Figure 4D) and 14 marginal hooklets. Length of median haptoral sclerites as follows: large hamulus, 141 ± 50 (88–246, n = 18) in length; small hamulus, 214 (84–289, n = 19) in length. Testes rounded, relatively large and unequal in size, located at midlevel of the body proper, length 228 ± 57 (128–356, n = 31); width 188 ± 44 (98–299, n = 31) for left testes and 224 ± 57 (108–319, n = 30) length, 173 ± 43 (94–258, n = 30) width for right testes (Figure 4). Vasa efferentia not observed. Vas deferens thick-walled, becoming convoluted alongside transverse vitelloducts, entering cirrus sac and enlarging into a fusiform internal seminal vesicle. Cirrus housed in cirrus sac, receiving posteriorly ejaculatory duct. Cirrus sac fusiform, muscular. Ovary anterior to tests, oval, giving rise to a long oviduct, length 109 (55–139, n = 29), 132 (64–198, n = 29) width. Ovo-vitelline duct and oötype not observed. Vitelline reservoir large. Vitellarium muscular, extending from level of ejaculatory duct to posterior end of body proper. Eggs not observed.

Discussion

To date, the genus Encotyllabe comprises 24 species, all of which are parasites of marine fish belonging to various families. They are found in a wide range of aquatic environments, including temperate, subtropical and tropical waters (Lebedev 1967; WoRMS 2023). Among these species, E. vallei is common in sparid fish species as indicated in Table 5. First described from S. aurata, it was reported on sparids mainly of the genus Diplodus (Martorell 2004). There is also a single mention of its occurrence on the common dentex D. dentex (Linnaeus, 1758) (Euzet et al. 1993), Dentex sp. (Palombi, 1949) and on the redbanded seabream Pagrus auriga Valenciennes, 1843 (Martorell 2004).

Table 5. Hosts and localities of E. vallei Monticelli, 1907. All localities are from the Mediterranean.

1 Reported as E. spari..

Furthermore, there have been records of E. vallei being on the striped red mullet, M. surmuletus Linnaeus, collected off the coast of Spain. However, the authors of this report suggested an accidental parasitism given that both the sparid type-host (S. aurata) and the mullet host (M. surmuletus) share the same habitat. Alternatively, it could potentially indicate the existence of a distinct species (Ferrer-Castello 2015). Most interestingly, in the figure’s caption, Ferrer Castelló (2015) additionally referred to four individuals of Encotyllabe found on the annular sea bream Diplodus annularis (Linnaeus, 1758) but did not discuss it further. Curiously, in previous investigations of the transmission of monogeneans in farmed fish, the authors noted the absence of transmission of E. vallei from S. aurata to D. labrax (Fernandez-Jover et al. 2010; Papoutsoglou 2016).

Mahmoud et al. (2014) attributed the capsalid Monogenea collected on S. aurata off Egypt, which is the usual host and the type-host of E. vallei to E. spari (Mahmoud et al. 2014). However, a closer examination and comparison of the photograph of their specimens with the illustration of E. spari provided by Yamaguti (1934) reveals slight differences in the position of tests and shape of large hamuli (see Figure 1 in Mahmoud et al. (2014) versus Figure 7 provided by Yamaguti (1934)). Additionally, E. spari was first described from three different hosts: the blackhead seabream Acanthopagrus schlegelii (Bleeker.) (jun. syn. Sparus macrocephalus (Basilewsky)), the trout sweetlips Plectorhinchus pictus (Tortonese) and Hong Kong grouper Epinephelus akaara (Temminck and Schlegel) from a distinct locality off Japan. It is highly likely that the capsalids reported by Mahmoud et al. (2014) are E. vallei.

We note that some authors referred to the ‘absence’ of a detailed redescription of E. vallei (Sepúlveda et al. 2014; Taborda et al. 2023). However, it should be noted that Radujkovic and Euzet (1989) did indeed provide a detailed and beautifully illustrated redescription of E. vallei, even though their specimens were collected from Montenegro and not from the type-host. Furthermore, it was sometimes mentioned that Monticelli reported E. vallei on S. aurata and Dentex sp. (Radujkovic and Euzet 1989; Zakia 2019). However, it is important to clarify that the original description of E. vallei was based on specimens collected from S. aurata, and the first mention on Dentex sp. was made by Palombi (1949). The illustrations and morphometric data, along with the molecular data generated herein, will provide satisfactory and reliable material for comparison and for understanding the patterns of host specificity of this monogenean.

The first 28S rDNA and cox1 sequences for species of Encotyllabe in the Mediterranean and of E. vallei were provided by Lablack et al. (2022), who conducted an extensive and valuable data collection of monogeneans from the southwestern Mediterranean. However, some issues arise when analyzing all records of Encotyllabe from sparids from Algeria:

In their study, Lablack et al. (2022) proposed the existence of two putative species within the genus Encotyllabe based on genetic divergence in the cox1 gene. The first putative species, referred to as Encotyllabe sp. 1, was found on Pagellus bogaraveo, while the second putative species, Encotyllabe sp. 2, was found concurrently on D. vulgaris and S. aurata. They observed a range of genetic divergence within these species that fell between 0% and 1.9%.

Lablack et al. (2022) considered this divergence to be ‘slightly higher’ than the upper limit of the intraspecific ranges observed in other Encotyllabe species, specifically referring to E. antofagastensis and E. cheilodactyli.

In light of the available data and taking into consideration the molecular data generated so far, it can be deduced that Encotyllabe sp. 1 is oioxenic, ¹ meaning it is highly specific and primarily associated with P. bogaraveo. On the other hand, Encotyllabe sp. 2 appears to be stenoxenic, indicating it exhibits a narrower host range, primarily infecting D. vulgaris and S. aurata.

A similar situation had been demonstrated for microcotylids from sparids: Microcotyle visa Bouguerche, Gey, Justine and Tazerouti, 2019 and M. isyebi Bouguerche, Gey, Justine and Tazerouti, 2019 are oioxenic to their hosts, Pagrus caeruleostictus (Valenciennes.) and Boops boops (Linnaeus.) (Bouguerche et al. 2019a, 2019b; Víllora-Montero et al. 2020); Microcotyle whittingtoni Víllora‑Montero, Pérez‑del‑Olmo, Georgieva, Raga and Montero, 2020 is oioxenic to D. dentex (Víllora-Montero et al. 2020), while the enigmatic M. erythrini Van Beneden et Hesse, 1863 is rather stenoxenic, occurring on Pagellus erythrinus (Linnaeus) and on P. pagrus (Linnaeus) (Víllora-Montero et al. 2020). Hence, we could assume that Encotyllabe sp. 1 is oioxenic while Encotyllabe sp. 2 is stenoxenic, but a more significant concern arises when trying to distinguish between Encotyllabe sp. 1 and Encotyllabe sp. 2. (1.1–1.9%) is well below the threshold for Monogenea and invertebrates, and higher divergences were used to separate Encotyllabe species (see Table 6). In the present analysis, the divergence of E. vallei from S. aurata ranged between 0–2 % which suggests that a single species is present in S. aurata. Similarly, the divergence between Encotyllabe from S. aurata, D. vulgaris and P. bogaraveo does not exceed 2%, below the interspecific divergence for cox1 known for Monogenea. We thus suggest that E. vallei is the sole species infesting the previously mentioned host.

Table 6. Intraspecific and interspecific variations of the cox1 gene within species of Encotyllabe

It is important to note that stenoxenic specificity is not unusual in Monogenea and has been previously demonstrated using molecular barcoding (Bouguerche et al. 2019a, Lablack et al. 2022; Víllora-Montero et al. 2020). For instance, the microcotylid M. erythrini was described from the sparid Pagellus erythrinus off Brest (Brittany, Atlantic Ocean) than recorded from three other hosts (Pagellus acarne, B. boops and D. dentex) in several localities in the Mediterranean (Bouguerche et al. 2019b). Despite the record of M. erythrini sensu lato from the record from B. boops being demonstrated to be a distinct species, M. erythrini sensu stricto had been shown to be exceptionally a stenoxenic microcotylid, occurring on P. erythrinus and P. pagrus (demonstrated by cox1 barcoding) (Víllora-Montero et al. 2020). Encotyllabe vallei presents another ‘enigmatic’ monogenean species, displaying a host specificity pattern distinct from that of its congeners.

In our current study, it is noteworthy that the molecular tree based on 28S sequences illustrates the monophyly of three subfamilies of capsalids: the Encotyllabinae, Benedeniinae and Capsalinae (Figure 2). Perkins et al. (2009), in a molecular study based on different markers, retrieved only the Capsalinae as monophyletic. Similarly, Gastineau et al. (2023) retrieved a monophyly of the Capsalinae, with representatives of all four genera of the subfamily (Capsala Bosc, 1811; Capsaloides Price, 1936; Tristoma Cuvier, 1817 and Nasicola Yamaguti, 1968) united together in a well-supported monophyletic clade. Results for other subfamilies were less in accordance with traditional taxonomy (Gastineau et al. 2023). Hence, future phylogenetic investigations, using more extensive datasets, will certainly offer a more comprehensive insight into the evolutionary history of capsalid monogeneans.

The distribution of Encotyllabe spp. according to the systematics of host groups is given in Table 1, which summarizes updated data originally compiled by Lebedev (1967). From the available data, a discernible pattern emerges in the geographical distribution of Encotyllabe species: Encotyllabe lintoni Monticelli, 1909; Encotyllabe monticelli Perez Vigueras, 1940 and Encotyllabe pricei Koratha, 1955 occur in North America. E. pagrosomi MacCallum, 1917 and Encotyllabe embiotocae Noble, 1966 occur in Pacific waters; E. chironemi is restricted to the coast of New Zealand and in the seas of Japan; Encotyllabe caranxi Lebedev, 1967 described from New Zealand-Australian fish; E. pagelli is known from the coast of Belgium and Ireland; E. spari Yamaguti, 1934; E. lutiani Tripathi, 1959 and E. masu Ishii and Sawada, 1938 is found off the coast of India. The Mediterranean species are E. vallei, E. paronae and E. nordmanni. The validity of all the Mediterranean species in addition to E. pagelli was questioned (Taborda et al. 2023). Another striking aspect when analyzing these data is that nearly all Encotyllabe spp. were described from a single host species or closely related host species, as previously noted by Taborda et al. (2023), suggesting host specificity. However, the findings presented in our study challenge the notion of strict host specificity for Encotyllabe, particularly for E. vallei indicating that it primarily associates with a narrower but still specific range of host species. A similar conclusion was reached for Encotyllabe species from Haemulidae hosts, as such Encotyllabe haemuli and E. antofagastensis which formed a well-supported clade (see Taborda et al. (2023)).

Determining the taxonomic status of Encotyllabe spp. presents a challenging task, as traditional taxonomy relies on a variety of morphological characteristics, including body shape, the relative sizes of several organs, the shape and relative position of the testes, the penis shape, the extension of the vitellaria and the size and shape of the anchors, as well as the relative distances between different organs (Robinson 1961; Sepúlveda et al. 2014; Taborda et al. 2023). However, it is important to note that the presence of an evaginated or protrusible pharynx, as suggested by Martorell (2004), adds a layer of complexity to this taxonomic classification. Considering this, it may be advisable to exclude the size of the pharynx as a definitive criterion for taxonomic differentiation.

Because P. bogaraveo is the type-host of E. pagelli (Van Beneden and Hesse 1863), we were at first tempted to suggest a synonymy between E. vallei and E. pagelli. However, we refrained from doing so as E. pagelli was first described from the Atlantic coast off Brest, France. In the absence of available morphological data for Encotyllabe from P. bogaraveo, it remains challenging to definitively determine the host specificity of E. vallei. There is the possibility that a species complex exists within individual sparid fish species, as has been observed in some other Encotyllabe species. The acquisition of morphometric and morphological data from specimens collected from P. bogaraveo would be instrumental in shedding light on the host specificity patterns of this capsalid and clarifying its taxonomic status within the genus.