The first study on opportunistic intestinal microsporidiosis in IBD patients receiving immunosuppressive medications in Iran

Summary

Microsporida are known as opportunistic unicellular organisms and have recently been reclassified as fungi that have been frequently reported from patients with congenital and acquired immunity failure disorders, worldwide. However, use of immunosuppressive medications in inflammatory bowel disease (IBD) patients significantly decreases overall immunity, and increases their susceptibility to opportunistic infections. Totally, 71 stool samples were collected from IBD patients consisted of 69 ulcerative colitis (UC) patients and two Crohn's disease (CD) patients. All patients had taken immunosuppressive and/or immunomodulator drugs for at least 3 weeks. DNA was extracted from all stool samples and Nested PCR was performed using genus-specific primers based on small subunit ribosomal RNA (SSU rRNA) gene. Fisher's Exact Test was applied to evaluate statistical association between microsporidia infection and sex, age and types of IBD. Mean of age ± s.d., women and men percentage of the attended patients were 36·17 ± 11·93, 60·6%, and 39·4%, respectively. A 440-bp fragment of SSU rRNA gene attributed to Enterocytozoon bieneusi was amplified from 12·7% of IBD patients. No Encephalitozoon DNA was detected in the samples. No microsporidia-positive sample was found in CD patients. Fisher's Exact Test showed that there was no statistically significant correlation between intestinal microsporidiosis and age, sex, and IBD types with P values: 0·389, 1·00, and 1·00, respectively. This study has shown IBD patients undergoing immunosuppressive/immunomodulators medications, which may be susceptible to intestinal microsporida infection. E. bieneusi is the commonest intestinal microsporidan reported from IBD patients.

Microsporida are known as opportunistic unicellular organisms and have recently been reclassified as fungi [1]. This microorganism has frequently been reported from both immunocompromised and immunocompetent individuals, as well as a broad range of animals all over the world [2, 3]. Microsporidia infection in immunocompromised patients, particularly HIV/AIDS patients, is one of the most important concerns of healthcare systems. Reports of microsporida infection have risen worldwide due to the increase in congenital/acquired immunity system disorders [4]. Enterocytozoon bieneusi is one of the most prevalent human-infecting microsporidan species reported from HIV/AIDS patients [5], patients undergoing chemotherapy [6], and individuals with immunity disorders.

Inflammatory bowel disease (IBD) is a complex gastrointestinal disorder and the etiological agent is not clearly known. Crohn's disease (CD) and ulcerative colitis (UC) are the two most important chronic IBD, frequently reported worldwide [7, 8]. Several genetic, environmental, and immunological factors have been suggested as triggers of immunological disorders and subsequent IBD. Nowadays, immunosuppressive/immunomodulatory agents such as corticosteroids and anti-inflammatory drugs are used to manage conditions of IBD patients [7]. However, the increasing use of immunosuppressive drugs in IBD patients, significantly decreases overall immunity and increases susceptibility to opportunistic infections. However, subsequent events of immunosuppressive therapy in IBD patients convinced the ECCF (European Crohn's and Colitis Foundation) to state that IBD patients on corticosteroids, biological agents, and immunomodulators are normally more susceptible to opportunistic pathogens [9].

Several studies have presented different opportunistic microbial pathogens from IBD patients [10]. Since intestinal microsporidiosis is considered as an opportunistic infection, frequently reported from immunocompromised patients, IBD patients undergoing immunosuppressive drugs could be more susceptible to this infection.

However, the current study is the first survey to investigate intestinal microsporidiosis in IBD patients undergoing immunosuppressive therapy.

Totally, 71 stool samples were collected from IBDs patients consisted of 69 UC patients and two CD patients who had been referred to IBD clinic of Research Institute for Gastrointestinal and Liver Diseases in Shahid Beheshti University of Medical Sciences, Tehran during May 2015 to April 2016. A trained interviewer filled up a questionary consisted of age, sex, and type of IBD. All patients had taken immunosuppressive and/or immunomodulator drugs for at least 3 weeks. Stool samples were immediately transferred to the Parasitology Laboratory of Foodborne and Waterborne Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases in Shahid Beheshti University of Medical Sciences and further investigations were carried out on the samples.

DNA extraction was performed for all stool samples using QIAamp DNA Stool mini Kit according to the manufacturer's instruction. Nested PCR was performed using genus-specific primers based on small subunit ribosomal RNA (SSU rRNA) gene according to the literature mentioned elsewhere [5]. Briefly, the first pair primers, PMicF (5′ – GGTTGATTCTGCCTGACG – 3′) and PMicR (5′ – CTTGCGAGC(G/A)TACTATCC – 3′), amplified 779 bp of SSU rRNA gene of Encephalitozoon spp. and Enterocytozoon bieneusi. The second PCR employed primers EnbF (5′ – GGTAATTTGGTCTCTGTGTG – 3′) and EnbR (5′ – CTACACTCCCTATCCGTTC – 3′) to amplify 440 bp as well as EncepF (5′ – AGTACGATGATTTGGTTG – 3′) and EncepR (5′ – ACAACACTATATAGTCCCGTC – 3′) to amplify 629 bp fragments for E. bieneusi and Encephalitozoon spp., respectively.

First, PCR reaction was performed in final volume 25 µl containing 12·5 µl of 2× Ampliqon PCR Master Mix (Denmark) 10 ρM of each primers. Amplifications were carried out in Eppendorf thermocycler (Hamburg, Germany). The conditions for the first PCR reaction were: 95 °C for 5 min followed by 35 cycles of 94 °C for 40 s, 55 °C for 45 s, 72 °C for 45 s, and final extension of 72 °C for 4 min. The second PCR conditions were: 95 °C for 5 min followed by 25 cycles of 94 °C for 35 s, 57 °C for 35 s, 72 °C for 40 s, and 72 °C for 3 min as a final extension. The 10 µl of PCR products were electrophoresed on 1·5% of agarose gel and were visualized after ethidium bromide staining. A positive (sequenced isolates with accession no. KJ414444) and negative (Sterile Distillated Water) control were run together with all samples.

Fisher's Exact Test was applied to evaluate statistical association between microsporidia infection and sex, age, and type of IBD using IBM SPSS Statistics for Windows, v22 (Chicago, IL, USA). A P-value <0·05 was considered statistically significant.

Totally, 71 patients including 69 (97·18%) and 2 (2·82%) had UC and CD, respectively. IBD and type of IBD were proven in all patients using by colonoscopy and pathology evaluations. Mean of age ± s.d., women and men percentage of the attended patients were 36·17 ± 11·93, 60·6% and 39·4%, respectively. All demographic data are summarized in Table 1. All enrolled patients had received one or several following drugs: Methyl-prednisolone or hydrocortisone, infliximab and mesalamine at least for 3 weeks. All patients had watery diarrhea or semi-form stool at the time of sampling.

Table 1. Demographic and summarized data of microsporidia infected patients among IBD subjects

* P-value was not applicable.

PCR reactions were carried out on all DNA extracted samples and nine (12·7%) samples were identified as positive. All nine positive samples showed 440 bp fragment of SSU rRNA gene attributed to E. bieneusi, while no DNA amplification was found by specific primers for Encephalitozoon spp. Furthermore, all E. bieneusi positive-samples were seen in UC patients (13·4%), while no positive sample was found in CD patients. Statistical analysis was performed and Fisher's Exact Test showed that there was no statistically significant correlation between intestinal microsporidiosis and age, sex, and IBD types with P-values: 0·389, 1·00, and 1·00, respectively.

Microsporida infection is one of the most important concerns and complications of physicians treating immunocompromised patients. Recently, gastrointestinal microsporidiosis was described as an emerging infectious disease reported from immunocompromised patients [5].

Nowadays, increase in the number of immune system disorders has led to opportunistic microorganisms being considered as one of the main secondary problems in immunocompromised patients. Several opportunistic microorganisms have been reported from IBD patients on corticosteroids, immunomodulators, and biological agents. Although the co-existence of some viruses, bacteria, and fungi were represented, there are scarce data available on opportunistic parasites in IBD patients [10].

Studies have reported the opportunistic infection of intestinal microsporidia from almost all countries [2]. However, gastrointestinal microsporidiosis not only decreases the life-quality of IBD patients, but also increases the intricacy of the therapy process. The current study is the first to report gastrointestinal microsporidiosis in IBD patients undergoing immunosuppressive therapy. Recently, Andreu-Ballester et al. suggested an etiological role for microsporidia in CD patients before immunosuppression and stated that due to deficiencies of δγT lymphocytes and IL-7, CD patients are likely to be more susceptible to colonization of intestinal microsporida. In contrast with our study, all enrolled patients in mentioned research had not been treated for CD and had not undergone immunosuppression therapy [11].

The prevalence rate of the microsporidia infection in the current study was 12·7%. In Iran, there are studies that described intestinal microsporidia from HIV/AIDS patients [5, 12], cancer patients under chemotherapy and transplant recipients [13]. A previous study from Iran by Mirjalali et al. showed high prevalence (30·86%) of E. bieneusi among HIV/AIDS patients, while some other studies reported lower rates of the infection [5]. Agholi et al. found E. bieneusi from 9·55% of HIV/AIDS patients and 6·81% of transplant recipient children in the south of Iran [12, 14]. In another study, Tabatabaie et al. reported prevalence rates of 5·3% and 4% for E. bieneusi and Encephalitozoon sp., respectively, in healthy subjects and 0·7% and 5·7% for E. bieneusi and Encephalitozoon sp., respectively, in various samples of immunocompromised patients [15]. In our study, only E. bieneusi was found in 12·7% of IBD patients who underwent immunosuppressive/immunomodulator medications. The prevalence rate of our study is similar and in agreement with other studies showing microsporidiosis in immunocompromised patients in Iran.

In the current study, only E. bieneusi was detected in all microsporidia-positive patients and no DNA of Encephalitozoon was amplified. Almost all previous studies in Iran showed that E. bieneusi had a higher prevalence rate [3, 5, 12, 14]. On the other hand, the interesting point is that metronidazole consumption with or without prescription is common in IBD patients to prevent diarrhea. Although, He et al. showed that metronidazole could be effective against Encephalitozoon spp. [16], but E. bieneusi is perceived as resistant to benzimidazoles such as metronidazole [17]. Therefore, the low prevalence of Encephalitozoon spp., compared with E. bieneusi in IBD patients, as our results showed, could be predictable.

In this study, no positive sample was detected in CD patients. This finding is more likely related to the number of CD patients. In Iran, the prevalence rate of UC is more than the CD cases [18] and unfortunately, at the time of sampling the number of CD cases was very low. However, intestinal microsporidia, particularly E. bieneusi, should be considered as one of the most important opportunistic microorganisms, capable of increasing the complexity of managing IBD patients.

IBD patients undergoing immunosuppressive, corticosteroid, and immunomodulator agents could be susceptible to intestinal microsporida infection. In addition, E. bieneusi is the commonest microsporidian species reported from this group of IBD patients.