Catch-at-size data of the eastern Atlantic skipjack were used to estimate changes in total mortality from 1969 to 2007. We used a transitional model of mean length that generalized the Beverton-Holt mortality estimator to allow change in mortality rate under nonequilibrium conditions. Then, from homogeneous periods of time, length-converted catch curves were used to access qualitative changes in selectivity patterns for two surface fisheries (the baitboat fishery operating from Dakar, Senegal, and the European and associated purse seine fisheries). To explore the impact of catch on the mortality rate, a Bayesian change-point analysis was conducted on the catch time series to detect concomitant variation between mortality rates and catch. Finally, potential causes of these changes are discussed in relation to the implementation of new fishing technology, such fish aggregating devices (FAD). The general pattern depicted by total mortality is in agreement with previous knowledge on this fishery: a state of complete or practically complete exploitation during the nineties followed by the decrease in nominal purse seine fishing effort in the last decade, combined with the effect of a seasonal moratorium on FAD fishing operations. There was no evidence of a change in selectivity between the two contrasted periods of time considered: 1969-1979 and 1986-1999; the second period being characterized by the introduction of new technology onboard vessels. In contrast, the covariation over time between total catch and mortality rate three years later highlights the effect of the fishing pressure on the stock of eastern Atlantic skipjack.

Fin spine ageing is the most common technique used to estimate age and growth parameters of large pelagic billfishes from the families Istiophoridae and Xiphiidae. The most suitable methods for processing and interpreting these calcified structures for age estimation have not been clearly defined. Methodological differences between unvalidated ageing studies are of particular concern for highly migratory species because multiple researchers in different regions of the world may conduct age estimates on the same species or stock. This review provides a critical overview of the methods used in previous fin spine ageing studies on billfishes and provides recommendations towards the development of a standardized protocol for estimating the age of striped marlin, Kajikia audax and white marlin, Kajikia albida. Three on-going fin spine ageing studies from Australia, Hawaii, and Florida are used to illustrate some of the considerations and difficulties encountered when developing an ageing protocol for highly migratory fish species. Particular areas of concern that may influence age and growth estimates included differences in fin spine selection, sectioning methods, criteria for identifying and measuring annuli, distinguishing false annuli, validation procedures, identification of the first annulus, and methods used to replace annuli lost due to vascularization of the fin spine core.

An ecological risk assessment (ERA; also known as productivity and susceptibility analysis, PSA) was conducted on eleven species of pelagic elasmobranchs (10 sharks and 1 ray) to assess their vulnerability to pelagic longline fisheries in the Atlantic Ocean. This was a level-3 quantitative assessment consisting of a risk analysis to evaluate the biological productivity of these species and a susceptibility analysis to assess their propensity to capture and mortality in pelagic longline fisheries. The risk analysis estimated productivity (intrinsic rate of increase, r) using a stochastic Leslie matrix approach that incorporated uncertainty in age at maturity, lifespan, age-specific natural mortality and fecundity. Susceptibility to the fishery was calculated as the product of four components, which were also calculated quantitatively: availability of the species to the fleet, encounterability of the gear given the species vertical distribution, gear selectivity and post-capture mortality. Information from observer programs by several ICCAT nations was used to derive fleet-specific susceptibility values. Results indicated that most species of pelagic sharks have low productivities and varying levels of susceptibility to pelagic longline gear. A number of species were grouped near the high-risk area of the productivity-susceptibility plot, particularly the silky (Carcharhinus falciformis), shortfin mako (Isurus oxyrinchus), and bigeye thresher (Alopias superciliosus) sharks. Other species, such as the oceanic whitetip (Carcharhinus longimanus) and longfin mako (Isurus paucus) sharks, are also highly vulnerable. The blue shark (Prionace glauca) has intermediate vulnerability, whereas the smooth hammerhead (Sphyrna zygaena), scalloped hammerhead (Sphyrna lewini), and porbeagle (Lamna nasus) sharks are less vulnerable, and the pelagic stingray (Pteroplatytrygon violacea) and common thresher (Alopias vulpinus) sharks have the lowest vulnerabilities. As a group, pelagic sharks are particularly vulnerable to pelagic longline fisheries mostly as a result of their limited productivity.


Fishery independent indices of spawning biomass of Atlantic bluefin tuna in western North Atlantic Ocean are presented which utilize National Marine Fisheries Service ichthyoplankton survey data collected from 1977 through 2007 in the Gulf of Mexico. Indices were developed using similarly standardized data from which previous indices were developed (i.e. abundance of larvae with a first daily otolith increment formed per 100 m2 of water sampled with bongo gear). Indices were also developed for the first time from standardized data collected with neuston gear [i.e. abundance of 5-mm larvae (i.e. seven-day-old larvae) per 10 minute tow]. Indices of larval abundance were developed using delta-lognormal models, including following covariates: time of day, time of month, area sampled and year. Due to the large frequency of zero catches during ichthyoplankton surveys, a zero-inflated delta-lognormal approach was also used to develop indices. Finally, a multivariate delta-lognormal approach was employed to develop indices of annual abundance based on both bongo and neuston catches. The results of these approaches were compared with one another and with other indices of larval abundance previously developed for the Gulf of Mexico. Residual analyses indicated that abundance indices of Atlantic bluefin tuna larvae were more appropriately developed from bongo-collected data through the zero-inflated delta-lognormal approach than other data sets and modeling approaches. Also, when modeling bongo-collected data with the zero-inflated delta-lognormal approach, the index values increased, indicating some correction for zero-inflation, and their variability decreased as compared to indices developed with the delta-lognormal approach.

The black-browed (Thalassarche melanophrys) and Atlantic yellow-nosed (Thalassarche chlororhynchos) albatrosses and the white-chinned petrel (Procellaria aequinoctialis) are the seabird species most frequently captured by pelagic longline fisheries in the southwest Atlantic. This study estimates this type of bycatch and describes the spatial-temporal patterns of the incidental capture of these species by the Uruguayan pelagic longline fleet, based on data collected by scientific observers on 47 fishing trips from 2004 to 2007. Three generalized linear models (GLM) models were employed to predict bycatch for each species based on the observed data. We also developed a spatio-temporal species-specific analysis. Captures were recorded in Uruguayan waters, mainly over the slope and depth waters, and in international waters adjacent to Uruguay, the north of Argentina, and the south of Brazil. The highest catch rates for black-browed albatrosses and white-chinned petrels were recorded on the Uruguayan slope from fall to spring, while the highest values for Atlantic yellow-nosed albatrosses were recorded further to the north, in the international waters off Brazil in late winter. The average estimated number of black-browed and Atlantic yellow-nosed albatrosses and white-chinned petrels caught during the study period was 1683, 257 and 239 birds, respectively. Taking into account the total effort of the fleet, these values represent an estimated catch rate of 0.276, 0.042, and 0.039 birds/1000 hooks for these species, respectively. The results of the present study suggest that the annual impact of this fishery is medium to high on the black-browed albatross, low on the Atlantic yellow-nosed albatross and low on the white-chinned petrel. However, the situation of these species in the southwest Atlantic should be viewed with considerable concern, as our understanding of the impact of the bycatch on their populations requires more research. Any effort to reduce seabird mortality in the southern hemisphere should target this geographic region.

The population abundance estimates used in stock assessments or required to establish management measures, depend on the sampling of the entire demographic spectrum of a population resident in a given area. However, for sea turtles, most population estimates are based mainly on nesting beach survey data and only consider a fraction of the population. The Southwest Atlantic Ocean (SWA) is an important foraging and development area for juveniles of the loggerhead sea turtle Caretta caretta where reproductive stocks from various nesting beaches mix. Declines in C. caretta populations have been observed in many parts of the world and bycatch rates of this species in the SWA are among the highest worldwide. This study standardizes the catch rates of loggerheads caught by pelagic longline fisheries in the region, using data collected by observer programs from Brazil and Uruguay. Generalized linear models (GLM) with a delta lognormal approximation were used. The variables used in the model take into account spatial and temporal variations as well as the characteristics of the fleet. In total, 6 272 344 hooks were observed between 1998 and 2007, with minimum effort registered in 2000 (12 010 hooks) and maximum effort in 2005 (1 989 431 hooks). During this period 3778 loggerheads were incidentally captured. The catch rates of loggerheads by the Uruguayan and Brazilian pelagic longline fisheries show oscillations through the years without a clear tendency; however, a low negative trend was observed from 1998 to 2005 with an increase in the last two years (2006 and 2007). The capture per unit of effort (CPUE) values varied between 0.38 to 1.78 ind/1000 hooks in 2005 and 2007, respectively. Distinct zones with differential catch rates were identified, with the higher CPUE values over the continental slope of Uruguay and adjacent waters. The incidental catch rates of this species are influenced, not only by fishing area, but also by year, season, sea surface temperature and gear type. In consequence, these variables and other potential ones should be considered in bycatch estimates by different fisheries because the loggerhead sea turtles are not uniformly distributed. This study intends to contribute not only to the general knowledge of loggerhead sea turtles in the SWA but to a future assessment of their populations at a global scale.

The design and evaluation of survey-based management strategies is addressed in this article, using three case-study fisheries: North Sea herring, Bay of Biscay anchovy and North Sea cod, with a brief history and the main management issues with each fishery outlined. A range of operational management procedures for the case study stocks were designed and evaluated using trends that may be derived from survey indices (spawner biomass, year-class strength and total mortality) with an array of simple and more structured observation error regimes simulated. Model-free and model-based indicators of stock status were employed in the management procedures. On the basis of stochastic stock-specific simulations, we identified the following key determinants of successful management procedures: (i) adequate specification of the stock-recruit relationship (model structure, parameter estimates and variability), (ii) knowledge of the magnitude and structure of the variation in the survey indices, and (iii) explication of the particular management objectives, when assessing management performance. More conservative harvesting strategies are required to meet specified targets in the presence of increasing stochasticity, due to both process and observation error. It was seen that survey-based operational management procedures can perform well in the absence of commercial data, and can also inform aspects of survey design with respect to acceptable levels of error or bias in the surveys.

Farfantepenaeus notialis (Crustacea, Decapoda) constitutes about 70% of the total shrimp catch in the Colombian Caribbean. In this study, we examined morphological characteristics of F. notialis to investigate stock differentiation, provided biological data such as size at 50% sexual maturity and discussed the importance of this information to fisheries management. The study was conducted in the Colombian Caribbean Sea from June to December of 2004 in four locations: Uraba gulf, Morrosquillo gulf, Amansaguapos, and La Vela cape. Individual shrimp were measured according to ten body segments and sex determined. We used discriminant function analysis (DFA) of size-adjusted data to generate two-dimensional plots of the morphometric indices to test for geographic variation in morphometry by mean of canonical dimensions. The length-frequency distributions showed statistically significant differences between the measurements of both sexes, males were smaller than female in all measures. In females, size range was 16 to 46 mm cephalothorax length (CL) and size at sexual maturity (CL50%) was 30.6 mm. Size range was 19 to 32 mm (CL) for males. The DFA of morphological differences between individuals (female/male) showed strong overlapping and no clear separation between regions. We did not find morphometric variability between regions, which indicates a single population of F. notialis from the morphometric point of view.

Melicertus kerathurus represents an economically important resource for fisheries and aquaculture. Seven microsatellite loci from 373 specimens of M. kerathurus collected in different parts of the Mediterranean and NE Atlantic were identified. Four of these microsatellites showed a moderate level of polymorphism, with 2 to 14 alleles per locus, whereas three had a monomorphic profile. Observed and expected heterozygosity ranged between 0.28 to0.64 and 0.28 to 0.65, respectively. Three microsatellite loci deviated from Hardy-Weinberg equilibrium in some populations, with a deficit of heterozygosity. Mean Fst values showed significant differentiation among sample sites analysed and indicate that these loci are useful for the study of genetic variation in this species. These results may supply functional information on the population genetic structure of Melicertus kerathurus, valuable for future sustainable management strategies.

During 84 days, the effects of density on juvenile sea bass (Dicentrarchus labrax) (76±16 g) were studied in an experimental tank-based flow through system. Performance, stress response and resistance to virus infection were analysed under five stabilized rearing densities: 10, 20, 40, 70 and 100 kg m-3. Water quality parameters (CO2, total ammonia nitrogen and O2) were measured and maintained close to the recommended values for farmed sea bass by adjusting water renewal exchange. No significant differences were observed between density treatments, neither on stress response (cortisol) nor susceptibility to nodavirus. With regards to biological performances, the daily feed intake and specific growth rate were significantly lower in fish reared at the 100 kg m-3 density. Results on the effects of density in sea bass reared in flow through (present study) and in recirculating aquaculture systems (RAS) (Sammouth et al. 2009) were compared as a contribution to the identification of density not affecting health and welfare in farmed sea bass.

Over the past decades, pollution, overfishing, and habitat degradation have driven the population size of Taiwan shoveljaw carp down markedly in Taiwan. Cryopreservation is a useful tool which could be used to maintain genetic resources to protect and preserve this endemic species. Four cryoprotectants [dimethyl sulphoxide (DMSO), dimethylacetamide (DMA), glycerol and methanol] and six freezing rates (0.5, 1, 2, 4, 8, 16 °C min-1) were tested in order to develop an optimal controlled slow-freezing protocol for Taiwan shoveljaw carp spermatozoa. Samples were subsequently examined under the scanning electron microscope to reveal whether cryopreservation had affected their ultrastructural morphology. The highest survival rate (50.1 ± 2.0%) was observed with a freezing rate of 8 °C min-1 in 1M DMSO, using SYBR-14 + PI staining. Fertility and hatching rate results using frozen-thawed spermatozoa (90.2 ± 2.2% and 22.3 ± 2.5%, respectively) were not significantly different from results with fresh spermatozoa. After cryopreservation, 21.0 ± 1.6% of frozen-thawed spermatozoa had mid-piece swelling and rupture of the head. Cryopreservation might, therefore, slightly affect Taiwan shoveljaw carp spermatozoa in terms of morphological change. However, these alterations could be compensated by using large enough numbers of normally functioning frozen-thawed spermatozoa to achieve a standard equal to fresh spermatozoa. This is the first report of successful cryopreservation of Taiwan shoveljaw carp spermatozoa using a controlled slow-cooling method.

Mikrocytos mackini is the etiological agent of Denman Island disease, which causes significant mortalities in commercially important bivalve species, including the Pacific oyster, Crassostrea gigas. A close relative of M. mackini, Mikrocytos sp., was recently detected in oysters imported into France from Canada. In this study, we examined Pacific oysters from the northern coast of the Yellow Sea, China. Of the one hundred samples examined histologically, a microcell parasite was found in the tissues of four oysters. To identify whether the parasite was Mikrocytos sp., DNA was extracted from the oysters and polymerase chain reaction (PCR) amplifications were performed with primers (Mikrocytos-F and Mikrocytos-R), which yielded the expected 522 bp fragment. DNA sequencing of these products confirmed that they were identical to the corresponding 18S region of Mikrocytos sp. (100%) and had close similarity to M. mackini (89%). In situ hybridization (ISH) also was performed in this study, and the primer pair MM-like (CCTGTCCTATGTCGGGCAGG) hybridized with the Pacific oyster parasite. This is the first report of Mikrocytos sp. in the Pacific oyster from the coast of China. Although this study suggests a low prevalence of the parasite in China, its potential threat to aquaculture should be considered.

Pearl oyster grafting is a complex surgical operation that should lead to pearl formation after approximately eighteen months. Although this technique has been used for many years in French Polynesia, the grafting process is still not standardised. While studies have been carried out in order to improve graft performance and yield, these remain highly variable due to post-grafting mortality, nucleus rejection and unreliable pearl quality, all of which constrain pearl farm profitability. The present study uses histological analysis to monitor oysters that either rejected or retained their nuclei. Both groups of oysters are compared in terms of evolution of the graft, which could influence retention, and the development of a pearl sac in cases where grafting was successful. Data show that rejection phenomena are linked to a number of causes, notably an inflammatory reaction in the “receiving” oyster, the presence of numerous tissue lesions and the quality of the grafted tissue. These results suggest that study is needed on the different concomitant elements of the grafting process: the graft “donor” oysters, the nucleus and the “receiving” oyster and their interactions.