The Ceratitis FARQ species complex consists of four highly destructive agricultural pests of Africa, namely C. fasciventris, C. anonae, C. rosa, and C. quilicii. The members of the complex are considered very closely related and the species limits among them are rather obscure. Their economic significance and the need for developing biological methods for their control makes species identification within the complex an important issue, which has become clear that can only be addressed by multidisciplinary approaches. Chromosomes, both mitotic and polytene, can provide a useful tool for species characterization and phylogenetic inference among closely related dipteran species. In the current study, we present the mitotic karyotype and the polytene chromosomes of C. rosa and C. quilicii together with in situ hybridization data. We performed a comparative cytogenetic analysis among the above two species and C. fasciventris, the only other cytogenetically studied member of the FARQ complex, by comparing the mitotic complement and the banding pattern of the polytene chromosomes of each species to the others, as well as by studying the polytene chromosomes of hybrids between them. Our analysis revealed no detectable chromosomal rearrangements discriminating the three FARQ members studied, confirming their close phylogenetic relationships.

Nile × blue tilapia hybrid (Oreochromis niloticus × O. aureus) has become an important food fish in intensive freshwater aquaculture. Recently, the parasite Myxobolus bejeranoi (Cnidaria: Myxozoa) was found to infect hybrid tilapia gills at high prevalence, causing immune suppression and high mortality. Here, we explored additional characteristics of M. bejeranoi–tilapia interaction, which enable efficient proliferation of this parasite inside its specific host. Highly sensitive quantitative polymerase chain reaction (qPCR) and in situ hybridization analyses of fry collected from fertilization ponds provided evidence to an early-life infection of fish by a myxozoan parasite, occurring less than 3 weeks post-fertilization. Because Myxobolus species are highly host-specific, we next compared infection rates in hybrid tilapia and in both its parental species following a 1-week exposure to infectious pond water. Analysis by qPCR and histological sections showed that while blue tilapia was as susceptible to M. bejeranoi as the hybrid, Nile tilapia appeared to be resistant. This is the first report of differential susceptibility of a hybrid fish vs its parental purebreds to a myxozoan parasite. These findings advance our understanding of the relationship between M. bejeranoi and tilapia fish and raise important questions regarding the mechanisms that allow the parasite to distinguish between very closely related species and to infect a specific organ at very early-life stages.

The family of interferon-inducible transmembrane proteins (IFITMs) plays a crucial role in inhibiting proliferation, promoting homotypic cell adhesion and mediating germ cell development. In the present study, the full-length cDNAs of zebrafish ifitm1 (744 bp) and ifitm3 (702 bp) were obtained by rapid amplification of cDNA ends (RACE). Reverse transcription polymerase chain reaction (RT-PCR) analysis showed that ifitm1 mRNA was expressed in the ovary, testis, brain, muscle, liver and kidney, while ifitm3 mRNA was only detected in the ovary. Based on in situ hybridization, ifitm1 mRNA was found to be strongly expressed in the ooplasm from stage I to stage II and ifitm3 mRNA was also strongly expressed in the ooplasm from stage I to stage II, furthermore ifitm3 expression ultimately localized to the cortex region beneath the plasma membrane of stage IV oocytes. During development, ifitm1 expression was initially detected in the enveloping layer cells and deep layer cells of shield stage embryos. Then, throughout the segmentation phase (10.25–24 hours post-fertilization (hpf)), ifitm1 expression was mainly detected in the head, trunk and tail regions. Unlike ifitm1, ifitm3 expression was initially detected in sphere stage embryos and was then broadly expressed throughout the embryo from the 70% epiboly stage to 24 hpf. Interestingly, ifitm3 was also expressed in primordial germ cells (PGCs) from the bud stage to 24 hpf. This expression analysis indicates that zebrafish ifitm1 may play a critical role in early organogenesis and may perform immune or hematopoietic functions and ifitm3 might be necessary for PGC migration and the formation of female germ cells.

The Colorado potato beetle (Leptinotarsa decemlineata, family Chrysomelidae), a phytophagous insect, which feeds preferably on potatoes, constitutes a serious pest of this crop and causes extensive damage to tomatoes and eggplants. It has a remarkable ability to develop resistance quickly against insecticides and shows a diversified and flexible life history. Consequently, the control of this pest has become difficult, requiring the development of new alternative biotechnology-based strategies. Such strategies require a thorough knowledge of the beetle's genome, including the repetitive DNA. Satellite DNA (stDNA), composed of long arrays of tandemly arranged repeat units, constitutes the major component of heterochromatin and is located mainly in centromeric and telomeric chromosomal regions. We have studied two different unrelated satellite-DNA families of which the consensus sequences were 295 and 109 bp in length, named LEDE-I and LEDE-II, respectively. Both were AT-rich (70.8% and 71.6%, respectively). Predictive models of sequence-dependent DNA bending and the study of electrophoretic mobility on non-denaturing polyacrylamide gels have shown that the DNA was curved in both satellite-DNA families. Among other features, the chromosome localization of both stDNAs has been studied. In situ hybridization performed on meiotic and mitotic nuclei showed chromosomes, including the X chromosome, with zero, one, or two stDNAs. In recent years, it has been proposed that the repetitive DNA may play a key role in biological diversification processes. This is the first molecular and cytogenetic study conducted on L. decemlineata repetitive DNA and specifically on stDNA, which is one of the important constituents of eukaryotic genomes.

Mikrocytos mackini is the etiological agent of Denman Island disease, which causes significant mortalities in commercially important bivalve species, including the Pacific oyster, Crassostrea gigas. A close relative of M. mackini, Mikrocytos sp., was recently detected in oysters imported into France from Canada. In this study, we examined Pacific oysters from the northern coast of the Yellow Sea, China. Of the one hundred samples examined histologically, a microcell parasite was found in the tissues of four oysters. To identify whether the parasite was Mikrocytos sp., DNA was extracted from the oysters and polymerase chain reaction (PCR) amplifications were performed with primers (Mikrocytos-F and Mikrocytos-R), which yielded the expected 522 bp fragment. DNA sequencing of these products confirmed that they were identical to the corresponding 18S region of Mikrocytos sp. (100%) and had close similarity to M. mackini (89%). In situ hybridization (ISH) also was performed in this study, and the primer pair MM-like (CCTGTCCTATGTCGGGCAGG) hybridized with the Pacific oyster parasite. This is the first report of Mikrocytos sp. in the Pacific oyster from the coast of China. Although this study suggests a low prevalence of the parasite in China, its potential threat to aquaculture should be considered.

Enkephalin peptides are present in the retina of several vertebrate species. In the avian retina, enkephalin immunoreactivity is primarily localized to a population of amacrine cells. In the present study, we determined the localization of cells expressing preproenkephalin (PPE) mRNA, which encodes the precursor of enkephalin peptides, in adult as well as in embryonic chicken retinas. The localization of PPE mRNA-expressing cells to the proximal inner nuclear layer (INL) in the adult chicken retina is similar to that of enkephalin-immunoreactive cells observed in previous studies, indicating that amacrine cells expressing PPE mRNA synthesize Met5- and Leu5-enkephalin peptides and related extended forms. Specific hybridization signal is absent in retinas at embryonic day (E) 11, but it is detected in retinas at E 15 and at hatching. PPE mRNA-expressing cells at these ages are located in the proximal INL, and they can be classified as amacrine cells on the basis of their soma size and laminar position. These findings confirm and extend previous observations on the presence of opioid peptides in amacrine cells of the chicken retina. The presence of PPE mRNA at embryonic ages, together with the evidence that enkephalins influence developmental processes, suggests that these peptides modulate retinal maturation in birds.

Immunohistochemistry and in situ hybridization were used to study the distribution of glycine receptor (GlyR) subunits and the GlyR-associated protein gephyrin in the rat retina. Monoclonal antibodies against the α and β subunits of the GlyR and gephyrin showed a strong punctate labeling pattern in the inner plexiform layer. Glycine receptor mRNAs were found in the inner nuclear layer and the ganglion cell layer. The α 1 subunit mRNA is predominantly present in the outer half of the INL and on some but not all ganglion cells. GlyR α2 subunit mRNA is predominantly present in the inner half of the INL and on nearly all cells in the ganglion cell layer. GlyR α3–, GlyR β-, and gephyrin-mRNAs are present in the entire INL and in cells in the ganglion cell layer. The differential expression of glycine receptor subunits indicates a functional diversity of glycine receptors in the retina.

We have studied the presence and distribution of α-amino-3–hydroxy-5–methyl-4–isoxazolepropionate (AMPA)-selective glutamate receptor subunits (GluR 1, 2, 3, and 4) in the adult cat visual cortical areas 17, 18, 19, and the lateral suprasylvian areas (LSA). Reverse transcription-polymerase chain reaction (RT-PCR) amplification indicated that the genes encoding GluR 1, 2, 3, and 4 are expressed in these areas and Western blot analysis revealed that the size of the corresponding peptides is similar to those described in the rat brain. In situ hybridization (ISH) using digoxigenin-labeled riboprobes showed that mRNAs coding for GluR1 and GluR3 were located in cells in all layers of the areas examined and also in the underlying white matter. GluR1 mRNA was relatively abundant throughout layers II–VI while GluR3 mRNA revealed a more laminated pattern of expression, preferentially labeling cells in layers II, III, V, and VI. The distribution of AMPA-selective receptor subunit peptides was studied by immunohistochemistry using subunit specific antibodies and found to be consistent with ISH results. In addition, we observed that most of the cells strongly labeled by the anti-GluR1 antibody were non-pyramidal neurons and that intense GluR2/3 immunoreactivity was seen preferentially in pyramidal neurons. Interestingly, double-labeling experiments indicated that neurons expressing γ-aminobutyric acid (GABA) as well as the GluR1 subunit were particularly abundant in deeper layers. The GluR4 peptide was predominantly found in a relatively low number of layer III and layer V neurons with either pyramidal or non-pyramidal morphology. Finally, the distribution of neurons expressing the various receptor subunits was similar in all the visual cortical areas studied. These findings indicate a high expression of GluR1–3 subunits in the cat visual cortex and that GluR1 and GluR2/3 subunits are particularly abundant in non-pyramidal and pyramidal neurons, respectively. In addition, the results described here provide a reference for future studies dealing with the effect of visual deprivation on the expression of this receptor type.

Teleost fish retinas continue to add neurons throughout life, and evidence from in vitro experiments have implicated insulin-like growth factors (IGFs) in this process. To discover whether these factors are expressed in vivo, we have examined their expression in the cichlid fish, Haplochromis burtoni. Three lines of evidence show that IGFs are present in the fish retina. An IGF-I specific antibody, sm 1.2, binds preferentially to the retinal outer plexiform layer, in areas of cone photoreceptor synaptic endings. Northern blots of mRNA hybridized with riboprobes from trout IGF-I and IGF-II genes revealed transcripts of ~6.5 and 4.9 kb, respectively. The IGF-I probe detected an additional transcript of 1.2 kb in liver but not in retinal mRNA. In situ hybridization with digoxigenin-labeled riboprobes revealed that the IGF gene product is localized in the cone photoreceptors. These results show that cone photoreceptors are the source of IGFs in the fish retina, consistent with the hypothesis that IGFs play a role in regulating production of new neurons in the teleost retina.

Endogenous opioid systems (i.e. opioid peptides and opioid receptors) modulate developmental events in the neonatal mammalian retina. In the present study, the mRNA encoding preproenkephalin A (PPE), the prohormone for the opioid growth factor (OGF), [Met5]-enkephalin, was studied in the developing and the adult retinas of rats. Northern analysis indicated the presence of a 1.4-kb message in the developing and adult retinas corresponding to rat PPE mRNA. Quantitation showed that PPE message was present on postnatal day 1 at 5% of the adult level, and increased during development until the adult quantity was reached by postnatal day 27. In situ hybridization experiments first detected the presence of PPE mRNA in retinal tissues during late gestation. In late prenatal and neonatal retinas, PPE message was associated with areas of the developing retina containing proliferating neuroblasts and postmitotic cells. Later in development, message appeared to be located primarily within the inner retina, with abundant PPE mRNA associated with putative horizontal cells of the inner nuclear layer (INL). The adult retina showed a similar pattern of PPE gene expression in the cells of the INL. These findings document that the gene expression in the retina for PPE begins in the fetus, continues during retinal development, and coincides with the presence of a PPE mRNA derivative ([Met5]-enkephalin) that regulates DNA synthesis during retinal ontogeny. Our results are also the first to show the presence of PPE message in the adult mammalian retina, suggesting transcription of an opioid gene in the mature visual system.

Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian retina. The present paper describes the localization of GABAA receptors in the rat retina as revealed by in situ hybridization and immunocytochemistry.

In situ hybridization with probes against various a subunits revealed a marked differential expression pattern. The αl subunit gene is expressed mainly in the bipolar and horizontal cell layer, the α2 gene in the amacrine and ganglion cell layer, and the α4 gene in a subpopulation of amacrine cells. β subunit mRNA is present diffusely throughout the entire inner nuclear layer and in the ganglion cell layer.

The monoclonal antibody bd 17 (against β2/β3 subunits) stained subpopulations of GABAergic and glycinergic amacrine cells as well as some ganglion cells and bipolar cells. Immunoreactivity was not restricted to synaptic input sites. In the outer plexiform layer bipolar cell dendrites were immunoreactive; in the inner plexiform layer mainly amacrine and ganglion cell processes were labeled, and bipolar cell axons appeared unstained. The results demonstrate a strong heterogeneity of GABAA receptors in the retina.

The localization of heat shock protein 70 (HSP70) and HSP70 mRNA in the heart, liver, lung, kidney, spleen, thymus and cloacal bursa in broilers that were heat stressed for 6 h was conducted using immunohistochemistry and in situ hybridization techniques. Positive HSP70 mRNA signals were detected in the liver and lung, especially in the vessel walls. A weak presence was found in the myocardial cells. No significant signals were observed in spleen, thymus and cloacal bursa. HSP70 was observed in the vessel walls of all investigated broiler tissues. Localizations of HSP70 and HSP70 mRNA suggest that HSP70 could be correlated with cardiovascular function.

We have been studying a seed aspartic proteinase, termed AtAP, from Arabidopsis thaliana. In previous work, we purified the proteinase, analysed its activity and isolated the cDNA sequence. In this paper, the expression of the mRNA for the aspartic proteinase was analysed in seed tissues both by Northern blots for overall regulation and by in situ hybridization to follow cell-specific localization of message. We found a 1.9 kb aspartic proteinase message in dry seeds and seed pods. This message was expressed in many different cell types of the mature dry seed. The localization of the protein within these cells was also determined. Antibodies were raised against the AtAP and purified using affinity chromatography on an AtAP–immobilized-pepstatin A–agarose column. This purified antibody recognized several AtAP peptides in seeds. To localize the enzyme in cells, we isolated protein bodies from the dry seeds of Arabidopsis using a non-aqueous isolation method. The AtAP activity and antigenic peptides were found to be highest in the protein body fraction and co-localized with the seed storage protein 2S albumin and the vacuolar marker enzyme α-mannosidase. This protein body localization of the AtAP was confirmed with immunocytochemical localization by electron microscopy and shows that the protein is not secreted by these cells.

Over the last decade the need for new strategies and compounds to control parasitic helminths has become increasingly urgent. The neuromuscular systems of these worms have been espoused as potential sources of target molecules for new drugs which may address this need. One facet of helminth neuromuscular biology which has garnered considerable research interest is that of neuropeptidergic neurotransmission, particularly regarding parasites of humans and animals, as well as free-living nematode model species. This research interest has been piqued by the fact that neuropeptides have been demonstrated to be fundamentally important to nematode biology and thus may be of utility in this search for new drug targets. This review focuses on the neuropeptide biology of plant parasitic nematodes, a subject which has been comparatively neglected despite the fact that the search for alternative control measures also extends to these economically important parasites. We focus on the FMRFamide-like peptide (FLP) neuropeptides and the complexity and distribution of this peptide family in plant parasitic nematodes. Possible roles for FLPs in plant parasitic nematode behaviour, as elucidated by a combination of molecular imaging techniques and RNA interference (RNAi), are discussed. We propose that disruption of FLP neurosignalling in plant parasitic nematodes represents a novel form of pest control and speculate as to how this may be achieved.

Recent findings in two rat models of absence epilepsy, the Wistar Albino Glaxo Rats from Rijswik (WAG/Rij) and the Genetic Absence Epilepsy Rats from Strasbourg (GAERS), support the idea that defects in the function of hyperpolarization-activated, cyclic nucleotide-gated cation channels (HCN1-4) and the resulting membrane current, Ih, in thalamocortical relay neurons are crucially involved in epilepsy. After a developmental evolution the expression of HCN1, which is relatively insensitive to cAMP, is elevated significantly in epileptic rats with no changes in expression of the other isoforms. This is accompanied by a hyperpolarizing shift in Ih activation and reduced sensitivity to cAMP. Thus, modification of thalamic Ih occurs at pre-epileptic stages and seems to be crucial to the development of spike-and-wave-discharges that characterize absence seizures.

Cell proliferation and apoptosis were measured in bovine mammary tissue around the time of peak milk production in three heifers, and compared with changes in the expression of bcl-2-related intracellular signals and apoptosis-inducing factor (AIF). Cell proliferation and apoptosis were relatively constant during the study period with no significant change in the incidence of either event. However, the ratio of apoptotic to proliferating cells tended to change from 0·99 on day 45 of lactation to 1·82 on day 63 (P=0·064), suggesting that in the course of the study, a dynamic balance may have been succeeded by net cell loss. Average milk production recorded 6 d after biopsy was correlated with the estimated number of cells (r=0·898; P<0·01) but not with the apoptosis to proliferation ratio (r=−0·224, P>0·05). Turnover of the cell population was associated with relatively constant expression of anti-apoptotic bcl-2. Competitive PCR also indicated expression of bax, in contrast to observations in lactating rodent mammary tissue. Bax expression was relatively low compared with that of bcl-2, but immunohistochemical staining for bax protein, which was not detectable on day 45, was observed on day 53 and, more intensely, on day 60 when the protein appeared to be membrane-associated. A partial coding sequence for bovine AIF was identified and AIF expression was evaluated by in situ hybridization. The results indicated that AIF was expressed in luminal alveolar cells and that, in concert with a change in bax to bcl-2 ratio, they might contribute to signalling of a change in the dynamic balance of the cell population as lactation progresses.

Primers and DNA probes designed for use in the specific detection of the paramyxean parasites Marteilia sydneyi and Marteilia refringens were tested for their potential to cross-react with closely related species in Polymerase Chain Reaction (PCR) and in situ hybridization. PCR primers and a DNA probe designed within the ITS1 rRNA of M. sydneyi were specific for M. sydneyi when compared with related species of Marteilia and Marteilioides. PCR primers designed within the 18S rRNA of M. refringens were specific in the detection of this species in PCR while a DNA probe (named Smart 2) designed on the same gene cross-reacted with M. sydneyi in tissue sections of Saccostrea glomerata as well as Marteilioides sp. infecting Striostrea mytiloides. Though not species specific, the Smart 2 probe provided a stronger signal in detection of all stages of M. sydneyi than the ITS1 probe. The ITS probe is proposed for use as a confirmatory diagnostic tool for M. sydneyi.

Glutamate and its various receptors are known to play an important role in excitatory synaptic transmission throughout the CNS, including the primary visual cortex. Among subunits of the AMPA receptors (α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid), subunit 2 (GluR2) is of special significance because it controls their Ca2+ permeability. In the past, this subunit has been studied mostly in conjunction with other AMPA subunits. The present study sought to determine if GluR2 alone has a distinct laminar distribution in the normal macaque visual cortex, and if its pattern correlated with that of cytochrome oxidase (CO) under normal and monocularly deprived conditions. In the normal adult cortex, GluR2 immunoreactivity (ir) had a patchy distribution in layers II/III, in register with CO-rich puffs. GluR2-ir highlighted the upper border of layer II, the lower border of layer IV (previously termed IVCβdark) and, most prominently, layer VI. Labeled neurons were primarily of the pyramidal type present in the upper border and lower half of layer VI, layers II/III, and scattered in layers V and upper IVB. Labeled nonpyramidal cells were large in layer IVB and small in IVCβdark. Notably, the bulk of CO-rich layers IVC and IVA had very low levels of GluR2-ir. At fetal day 13, however, GluR2 labeling showed a honeycomb-like pattern in layer IVA not found in the adult. A fragment of GluR2 cDNA was generated from a human cDNA library, and in situ hybridization revealed an expression pattern similar to that of GluR2 proteins. After 1–4 weeks of monocular impulse blockade with tetrodotoxin (TTX), alternating rows of strong and weak GluR2-ir in layers VI and II/III appeared in register with CO-labeled dark and light ocular dominance columns in layer IVC and puffs in II/III, respectively. Our results indicate that various cortical layers are differentially influenced by glutamate. The bulk of the major geniculate-recipient layers IVC and IVA have low levels of GluR2, presumably favoring synaptic transmission via Ca2+-permeable glutamate receptors. GluR2 plays a more important role in supragranular and infragranular layers, where the initial geniculate signals are further modified and are transmitted to other cortical and subcortical centers. The maintenance of GluR2 in these output layers is governed by visual input and neuronal activity, as monocular impulse blockade induced a down-regulation of this subunit in deprived ocular dominance columns.

The presence of intracellular bacteria in the dinoflagellate Gyrodinium instriatum Freudenthal & Lee has previously been described but the bacterial flora associated with this species has not been characterized. In this study, new results of transmission electron microscopy (TEM) and in situ hybridization using several bacterial group-specific oligonucleotide probes are presented. The long-term association of endocytoplasmic and endonuclear bacteria with G. instriatum has been confirmed. All endonuclear and most of the endocytoplasmic bacteria labelled were identified as belonging to the betaproteobacteria. Large clusters of Cytophaga-Flavobacterium-Bacteroides (CFB) were labelled and observed in the cytoplasm of the dinoflagellate cells, but were absent from the nucleus. Gammaproteobacteria were only observed outside the dinoflagellates. No alphaproteobacteria were detected either free-living or intracellular. Empirical observation of intracellular CFB reflected a degradation process of moribund dinoflagellate cells, whereas the systematic colonization of dinoflagellate nucleoplasm by betaproteobacteria suggested a true symbiotic relationship. Natural colonization may have occurred, perpetuated by vertical transmission of intracellular bacteria to the dinoflagellate daughter cells, via a pool of bacteria sequestered within the nucleus. Dividing bacteria were observed in the nucleus and equilibrium may be maintained by release of endonuclear bacteria to the cytoplasm through nuclear envelope constrictions.